mainPremium

1 Saatteeksi

Sinulle toimitettava raportti pitää sisällään tietoa sopivasta ruokavaliostasi, liikuntaan ja urheiluun liittyvistä ominaisuuksistasi, harjoitteluvasteistasi, palautumisestasi, unestasi sekä monista muista tärkeistä ominaisuuksistasi.

Analyysin perusteena on tieteellisesti tutkittu tieto kaikista osa-alueista. Valmista analyysiä lukiessasi Sinun on oltava tietoinen, että tarjottu tieto voi joiltakin osin hämmentää Sinua. Testin luonteen johdosta tämä ei ole todennäköistä. Analyysimme ei ole lääketieteellinen diagnoosi vaan kartoitus geneettisistä vahvuuksistasi sekä ominaisuuksistasi.

Tieteellisen tutkimustiedon luotettavuudesta vastaavat ainoastaan tutkimuksia tehneet tutkijat sekä tutkimustietoa julkaisseet instituutiot ja laitokset.

Evogenom Oy on suomalainen bioteknologiayritys, jonka tarkoituksena on edistää terveyttä ja hyvinvointia genetiikan avulla. Olemme sitoutuneet yhtiönä tuottamaan ensiluokkaista ja eettistä palvelua. Toimintaperiaatteinamme ovat luottamuksellisuus, yksityisyys, kohteliaisuus sekä tieteellisyys. Yrityksemme on syrjinnästä vapaa alue ja kaikki ovat meille yhdenvertaisia. Tavoitteenamme on geenianalyysien avulla auttaa ymmärtämään perimäämme ja tuntemaan geneettisiä vahvuuksiamme sekä ominaisuuksiamme.

Palvelun tuottamisessa Evogenom Oy vastaa, että analyysi- ja tuotantoprosessit noudattavat Suomen henkilötietolainsäädäntöä. Sinua koskevaa geneettistä dataa ei säilötä. Data tuhotaan, kun olet saanut analyysisi. Niin ikään toimittamasi näyte tuhotaan, kun lopullinen analyysi on toimitettu Sinulle. Evogenom Oy ei luovuta geenidataa prosessin ulkopuolisille kolmansille osapuolille.

Tietoturvaan liittyvistä syistä geneettistä dataasi ei analysoida tietokoneella, joka on kytkettynä internetiin. Lisäksi Sinua koskevaa dataa ei säilytetä internetissä eikä analyysisi ole saatavilla internetitse, ellet jostain erityisestä syystä nimenomaisesti pyydä meitä toimittamaan analyysiisi liittyviä seikkoja tätä kautta.

2 Lukuohje

Geenitestillä tutkitaan perinnöllisiä ominaisuuksiasi, jotka ovat periytyneet Sinulle omilta vanhemmiltasi. Raportissa esitettyjen yksittäisten tulosten taustalla on suuri määrä valideja tieteellisiä tutkimuksia, joihin raporttiin kirjautuvat diagrammit ja sanalliset yhteenvedot perustuvat. Näistä esimerkki seuraavalla sivulla!

Tulokset ovat analysoituja geenejä omasta näytteestäsi, eivätkä näin ollen ota huomioon elämäntapojesi vaikutusta, ympäristötekijöitä tahi liikunnan harjoittelutaustaasi saati mahdollisia sairauksia. Analyysimme perustuu olettamukseen, että olet perusterve eikä Sinulla ole mitään lääketieteellistä seikkaa, joka tulisi ottaa huomioon esim. todennäköisyyksiä laskettaessa. Niin ikään käyttämämme tutkimukset perustuvat tämän hetken parhaaseen tieteelliseen tietoon, ja täten tulosten tulkinta saattaa muuttua tulevaisuudessa.

Meidän jokaisen genomimme rakentuu neljästä erilaisesta emäksestä (A, C, T ja G). Nämä muodostavat keskenään kaksi erilaista paria, AT ja CG, ja näin yhdistyen rakentavat henkilökohtaisen, noin 3 miljardia emäsparia pitkän DNA-molekyylimme. Otos DNA-molekyylistäsi voisi näyttää esimerkiksi tältä:

ATGTAGTAGTATGTACTCTATTGATTCTAATGTAGTAG
TATGTACTCTATTGATTCTAATGTAGTAGTATGTACTC
TATTGATTCTATACATCATCATACATGAGATAACTAAG
ATTACATCATCATACATGAGATAACTAAGATTACATCA
TCATACATGAGATAACTAAGAT

Geeniluentamme tutkii näistä noin 3 miljardista emäsparista hieman yli 700 000 yksittäistä muunnosta eli SNPiä (Single Nucleotide Polymorphism). Näistä muunnoksista suurin osa sijaitsee geenien sisällä ja joidenkin niiden aiheuttamista vaikutuksista on tutkimuskirjallisuusnäyttöä, jonka avulla pystymme kertomaan Sinulle yksityiskohtia omasta elämänreseptistäsi. Luentamme tarkkuus on keskimäärin noin 99,5 %, joten analyysimme on yksittäisen ominaisuuden suhteen hyvin paikkansapitävä, mutta ei täydellisen tarkka.

Noin 20-50 % tiettyyn ominaisuuteesi liittyvistä seikoista voi perustua genotyyppiisi eli perimäsi muuttumattomaan koodiin. Fenotyyppi eli ilmiasu puolestaan tarkoittaa olemassaolevien, havaittavien ominaisuuksiesi ajan myötä muodostamaa kokonaisuutta eli Sinua. Siihen sisältyvät biokemialliset, käyttäytymykselliset ja fysiologiset ominaisuudet. Asiaa voi havainnollistaa esimerkiksi ajattelemalla kasvin siementä: samasta siemenestä (genotyypistä) kasvaa ympäristön laadusta riippuen joko pieni (huono maa, vähän valoa jne.) tai suuri (hyvä ruokamulta, paljon valoa jne.) kasvi. Ilmiasusi on siis perimäsi ja ympäristövaikutuksen yhteistulos.

Geenitestaus määritteleekin täten enemmän mahdollisuuksiasi kuin tämänhetkistä tilaasi. Liikunta- ja urheilusuoritukseesi vaikuttavat perinnöllisten ominaisuuksiesi lisäksi aina harjoittelutaustasi. Esimerkiksi säännöllinen voimaharjoittelu lisää lihasmassaa ja -voimaa, vaikka geneettiset taipumuksesi olisivatkin suurimmaksi osaksi kestävyysliikuntaa suosivia ominaisuuksia. Lisäksi vallitsevat olosuhteet, kuten lämpötila, ikä, suoritustekniikka, motorinen taito, ruokavalio, koettu stressi, unen määrä ja laatu sekä vireystilasi vaikuttavat ilmenevään suorituskykyysi.

On siis tärkeää muistaa, että DNA-testin tulos osoittaa nimenomaan perimääsi perustuvan analyysin taipumuksistasi ja ominaisuuksistasi. Esimerkiksi luontainen D-vitamiinitaso ja D-vitamiinin tuotanto elimistössäsi ei ole sama asia kuin verikokeessa selvitetty näytteenoton aikainen tila, jos olet nauttinut säännöllisesti D-vitamiinivalmisteita. Oma analyysisi antaa Sinulle kuitenkin vankkaa perustietoa siitä, miten kehosi toimii luontaisesti perimäsi ansiosta ja millaisia erilaisia mahdollisuuksia sinulla on. Toivomme mielenkiintoisia oivalluksia raporttisi parissa!

terveisin Evogenomin tiimi

3 Esimerkkejä raporttisi palkeista:

3.1 Kolme palkkia:

bars

Oma tuloksesi:
Tätä esitystapaa käytetään, kun ominaisuudessa on kolme erilaista mahdollisuutta. Tässä tapauksessa ominaisuus on pienimmillään…

bars

Oma tuloksesi:
… ja tässä tapauksessa suurimmillaan.

bars

Joissain tapauksissa palkkeja saattaa olla vain yksi kolmesta, mutta teksti kertoo silti ominaisuuden olevan keskitasoa. Tällöin kaksi tai kolme palkkia olisivat molemmat suurempia kuin keskiverto taso, jota yksi palkki siis kuvaa.

3.2 Kaksi palkkia:

bars

Oma tuloksesi:
Joissain tapauksissa ominaisuudessa on kaksi eri vaihtoehtoa. Tällöin käytetään joko yhtä …

bars

Oma tuloksesi:
… tai kahta palkkia.

bars

Joissain tapauksissa palkit saattavat olla täynnä, mutta teksti kertoo silti ominaisuuden olevan keskivertoa tasoa. Tällöin puolestaan kyseisessä ominaisuudessa paras mahdollinen ominaisuus on keskiverto taso, ja pienempi määrä palkkeja tarkoittaisi, että ominaisuus olisi keskivertoa pienempi.

Yleisesti ottaen teksti kertoo ominaisuuden luonteen ja kuva on paikalla avustamassa. Jos teksti ja palkit vaikuttavat jostain syystä olevan ristiriidassa, kertoo teksti asian todellisen laidan. Hyviä lukuhetkiä!

uni 4 Uni ja lepo

4.1 Unen määrä

Useimmille aikuisille ihmisille pitkällä aikavälillä tarvittava unen vähimmäismäärä on seitsemän ja yhdeksän tunnin välillä, keskiarvon ollessa kahdeksan tuntia. Krooninen unen puute on terveysriskin lisäksi suuri riski mm. liikenteessä ja tarkkuutta vaativassa työssä. Unentarpeesta huoletiminen on terveyden ja toimintakyvyn ylläpitämisen kannalta erittäin tärkeää, ja useimmat suomalaiset nukkuvatkin valitettavasti säännönmukaisesti liian vähän. Uni on, vanhaa sanontaa laajentaaksemme, kaiken ikäiselle kuin rahaa pankkiin laittaisi! Joillakin harvoilla ihmisillä on perinnöllinen kyky tulla toimeen pienemmällä unimäärällä ja silti säilyttää normaali toimintakyky. He eivät tarvitse samassa määrin unta kuin keskivertoyksilö, vaan nukkuvat säännönmukaisesti 1-2 tuntia vähemmän. Geeniesi tulos unentarpeesi suhteen on:

Oma tuloksesi:
Perinnöllinen unentarpeesi on väestön keskiarvoa vähäisempi. Näiden geeniesi perusteella tarvitset vähemmän unta ja voit täten pysyä virkeänä vähemmällä unella kuin keskivertoyksilö.

bars

4.2 Vuorotyö

Vuorotyön on todettu nostavan riskiä useille sairauksille. Jotkut ihmiset ovat mielummin vuorotyössä kuin toiset, ja tutkimuksissa on havaittu geneettinen ominaisuus, joka lisää todennäköisyyttä päätyä vuorotyöalalle. Tämä ei silti tarkoita, että vuorotyö olisi terveysvaikutuksiltaan heille vähemmän haitallista. Perimäsi vaikuttaa asiaan seuraavasti:

Oma tuloksesi:
Näiden geeniesi perusteella todennäköisyytesi päätyä vuorotyöalalle ei ole kohonnut, eli sinulla ei siis ole erityistä geneettistä taipumusta vuorotöissä työskentelemiseen.

bars

4.3 Unen syvyys ja rauhallisuus

Todennäköisesti jokainen meistä arvostaa rauhallista, rikkoutumatonta yöunta. Jotkut meistä nukkuvat syvemmin kuin toiset, häiriintymättä esimerkiksi ulkoa kuuluvista äänistä. Useimpien geenit eivät onneksi ole tässä esteenä, mutta joillain meistä on harvinaisempi geenimuunnos, joka tekee unesta lyhytsyklisempää. Tämä johtaa yöllisen heräilyn lisääntyneeseen määrään ja saattaa olla häiritsevää, jos unta ei saa helposti uudelleen. Omat geenisi vaikuttavat asiaan seuraavasti:

Oma tuloksesi:
Nämä geenisi lyhentävät unisykliäsi. Täten unesi voi olla rauhattomampaa ja saatat heräillä unestasi keskivertoa useammin. Nukkumisympäristön muokkaaminen mahdollisimman rauhalliseksi voi edesauttaa unenlaatuasi.

bars

4.4 Vuorokausirytmi ja unen alkamisajankohta

Ihmisillä on sisäinen kello, jonka vuorokauden pituus on hieman yli 24 tuntia. Jotkut valvovat yleensä myöhempään kuin toiset, jotka saattavat suunnistaa höyhensaarille hyvinkin aikaisin. Ihmisten luontainen nukkumaanmenoaika vaihtelee niin opittujen tapojen kuin elämäntilanteenkin kautta, ja myös perinnöllisillä taipumuksilla on vaikutusta asiaan. Joillain henkilöillä perintötekijät suosivat aamuvirkkua elämäntapaa, ja joillain toisilla taas paras aktiivisuuden vaihe tulee vasta iltapäivästä tai illasta. Aamuvirkut myös nukkuvat keskimäärin hivenen enemmän kuin iltavirkut. Iltavirkut puolestaan saattavat kärsiä ajoittaisesta unettomuudesta ja suosia esimerkiksi töitä, jotka tapahtuvat ilta-aikaan. Perintötekijäsi määrittävät vuorokausirytmiäsi seuraavasti:

Oma tuloksesi:
Perimäsi suoma vuorokausirymisi on väestön keskiarvon suuntaista. Jos ulkoiset tekijät eivät vaikuta rytmiisi, et ole erityisen aamuvirkku, mutta et myöskään iltamyöhään valvoja. Elämäntapojesi ja ympäristön ohjaamana saatat silti suosia jompaakumpaa vuorokausirytmiä.

bars

nautintoaineet 5 Nautintoaineet

5.1 Kahvi ja kofeiini

5.1.1 Kofeiinin poistumisnopeus

Joillakin ihmisillä kofeiini poistuu elimistöstä nopeammin kuin toisilla. Esimerkiksi vastasyntyneillä kofeiinia poistava entsyymi alkaa toimia kunnolla vasta noin puolen vuoden ikäisenä, ja runsaasti kofeiinia ennen imetystä nauttivilla äideillä rintamaitoon erittyvä kofeiini saattaa pitää vauvan valveilla. Täysikasvuisilla kofeiiniaineenvaihdunta on puolestaan joskus huomattavankin nopeaa, ja silloin vastuussa on eräs maksan sytokromientsyymeistä, CYP1A2.

Oma tuloksesi:
Näiden muunnelmiesi perusteella kofeiinin poistuminen elimistöstäsi on hitaampaa kuin väestöllä keskimäärin. Kofeiini vaikuttaa siis elimistössäsi tavanomaista kauemmin.

bars

5.1.2 Kofeiinipitoisten juomien määrä

Taipumus kofeiinipitoisten juomien nauttimiseen vaihtelee ihmisten välillä runsaastikin. Joillain kahvihammasta kolottaa herkemmin kuin toisilla, ja kahvi maistuu pitkin päivää. Toleranssin kehittyminen ja ylläpito osaltaan selittää tämän, mutta myös geeneillä on vaikutuksensa näiden juomien kulutukseen.

Oma tuloksesi:
Perintötekijöidesi näkökulmasta katsottuna juot kofeiinipitoisia juomia, esimerkiksi kahvia, enemmän kuin keskiverron määrän.

bars

5.1.3 Kofeiinin haittavaikutukset

Joillekin ihmisille kofeiini tuottaa runsaasti käytettynä erilaisia epämiellyttäviä vaikutuksia, kuten ahdistusta ja sydämentykytystä. Tutkimuksissa on löydetty vastaavuus eräiden geenien muunnelmien ja ahdistuksentunteen keskivertoa suuremman määrän välillä. Alla on laskettuna henkilökohtainen perinnöllinen kofeiinireaktiosi:

Oma tuloksesi:
Näiden perintötekijöidesi perusteella kofeiini voi lisätä ahdistuneisuudentunnettasi, erityisesti jos nautit sitä 150 milligrammaa tai yli. Tämä määrä on noin puolessatoista keskikokoisessa kahvikupillisessa.

bars

5.2 Alkoholi

5.2.1 Alkoholin kulutustottumukset

Ihmisten alkoholinkulutus vaihtelee runsaasti. Esimerkiksi joillekin alkoholipitoiset juomat aiheuttavat suuremman vasteen, ja sama alkoholimäärä saattaa täten tuntua suuremmin päihdyttävältä. Tähän vaikuttavat monet seikat, esimerkiksi toleranssi ja nautitun ruoan määrä. Osaltaan alkoholin kulutustottumuksiin vaikuttavat myös perintötekijät - runsaasti alkoholia käyttäville juominen saattaa tuntua geneettisistä syistä miellyttävämmältä kuin muille ihmisille.

Oma tuloksesi:
Näiden geeniesi puolesta kuulut alkoholia keskivertoa enemmän kuluttavaan väestöryhmään, eli Sinulla on perinnöllinen taipumus nauttia alkoholia keskivertoa runsaammin.

bars

5.2.2 Alkoholin aiheuttama punoitusreaktio

Alkoholin aineenvaihdunta on tietyn geenimuunnoksen johdosta joillain ihmisillä haastavampaa kuin toisilla. Tämä geenimuunnos on erityisen yleinen Aasiassa, mutta sitä esiintyy myös muualla. Kun tämän geenimuunnoksen kantaja nauttii alkoholia, sen aineenvaihduntatuote asetaldehydi ei poistu yhtä nopeasti kuin pitäisi. Tämä puolestaan aiheuttaa asetaldehydin kertymisen elimistöön ja sitä kautta mm. tunnusomaisen punoitusreaktion, joka keskittyy lähinnä kasvoihin ja ylävartaloon. Vastaava reaktio tavanomaisella genotyypillä saadaan esimerkiksi antabus-lääkettä nautittaessa. Tunne koetaan epämiellyttäväksi ja tämän ominaisuuden kantajien keskuudessa alkoholin nauttiminen on yleensä harvinaisempaa.

Oma tuloksesi:
Sinulla on antabusreaktion aiheuttava ALDH2-entsyymiversio. Tämän perintötekijän suhteen saatat kokea juomisen jälkeisen krapulan tavanomaista voimakkaammin, ja krapulan tuntemukset saattavat alkaa nopeastikin juomisen aloittamisen jälkeen.

bars

painonhallinta 6 Painonhallinta

6.1 Perusaineenvaihdunta

Kehomme kuluttaa levossakin energiaa perustoimintojen, kuten solunjakautumisen ja lämpötilan säätelyn ylläpitämiseen. Joillakuilla lämmöntuotanto toimii hiukan eri tavalla. Heidän elimistönsä valmistaa vähemmän lämmöntuotosta vastaavia ruskeita rasvasoluja. Tällöin lämpöä tuotetaan perusaineenvaihdunnassa vähemmän ja säästynyt energia varastoidaan rasvana valkoisiin rasvasoluihin. Myös kylmä saattaa tuntua epämiellyttävämmältä pienemmän lämmöntuotannon tähden.

Oma tuloksesi:
Näiden geeniesi puolesta perusaineenvaihduntasi on hieman keskimääräistä hitaampi. Elimistösi siis tuottaa lämpöä vähemmän ja varastoi energiaa tehokkaammin.

bars

6.2 Painonpudotuksen helppous

Joillain ihmisillä keho varastoi energiaa tehokkaammin kuin toisilla. Esihistoriallisina aikoina, ruoansaannin ollessa epäsäännöllisempää, tämä saattoi merkitä eroa elämän ja kuoleman välillä. Nykyään ruoan määrän yltäkylläisyys on kääntynyt ennen suosiollista genotyyppiä vastaan, ja kerätty vararavinto saattaa pysytellä mukana huomattavan sitkeästi painonkaristamisyrityksistä välittämättä.

Oma tuloksesi:
Näiden geeniesi puolesta elimistösi varastoi energiaa tavanomaisella tehokkuudella. Perimäsi ei hankaloita painonpudotusta väestön keskiarvoon verrattuna.

bars

6.3 Ravinto ja painonpudotus

6.3.1 Kuidut ja painonpudotus

Kuitujen saanti on hyödyllistä mm. suolistoterveyden ja vatsan normaalin toiminnan ylläpitämisen kannalta. Joillain ihmisillä perinnölliset tekijät antavat runsaasta kuidunsaannista myös lisäetua painonpudotukseen, jolloin laihduttaminen on helpompaa.

Oma tuloksesi:
Näiden geeniesi perusteella runsas kuidunsaanti edesauttaa painonpudotustasi. Painoa pudottaessasi sinulle on edullisinta saada ravinnostasi vähintään 30 grammaa kuituja päivittäin.

bars

6.3.2 Rasva ja painonpudotus

Rasvansaanti vaikuttaa eri ihmisillä eri tavoin, ja joillekin on helpompaa pudottaa painoa monella erilaisella ruokavaliolla. Toisilla taasen esimerkiksi rasvansaanti hidastaa painonpudotusta suhteessa paljon enemmän kuin toisilla, jolloin ruokavaliosuunnittelusta saatava etu on vastaavasti suurempi.

Oma tuloksesi:
Jos ruokavaliosi energiansisällöstä enintään 20 % tulee rasvasta, painonpudotuksesi on helpompaa ja veren glukoosi- sekä insuliinitasosi pysyvät paremmin alhaisemmalla tasolla.

bars

6.3.3 Lihasmassa ja painonpudotus

Painoa pudotettaessa keho vähentää sekä rasvan että lihasmassan osuutta. Oikealla ruokavaliolla ja harjoittelulla voidaan vaikuttaa asiaan, jos halutaan esimerkiksi vähentää pääasiassa rasvamassaa mutta koettaa säilyttää lihasmassaa. Joillain yksilöillä perintötekijät mahdollistavat lihasmassan paremman säilyttämisen tiettyjen ruokavalioiden yhteydessä.

Oma tuloksesi:
Näiden geeniesi puolesta ravinnon mukana saadun rasvan suhteellisen suuri osuus edesauttaa lihasmassasi säilymistä painonpudotuksen yhteydessä. Sinulle edullisin tapa ehkäistä lihasmassan suhteellista vähenemistä on ruokavalio, jossa 40 % päivittäisestä energiansaannista koostuu rasvasta.

bars

6.4 Ravinto ja painonhallinta

6.4.1 Hiilihydraatit ja painonhallinta

Tutkimuksissa on havaittu yhteys perintötekijöiden ja hitaiden hiilihydraattien edullisen vaikutuksen välillä. Joidenkin ihmisten elimistö hyötyy enemmän hitaista hiilihydraateista ja päivittäisen energiasisällön ollessa enemmän niihin päin kallellaan painonhallinta on helpompaa kuin keskiverrolla ihmisellä.

Oma tuloksesi:
Perimäsi puolesta hitaita hiilihydraatteja sisältävät ruoka-aineet ovat hyödyllisiä painonhallintasi kannalta. Sinulle painonhallinta on helpompaa, jos saat ravinnostasi vähintään 140 grammaa hitaita hiilihydraatteja päivittäin.

bars

6.4.2 Tyydyttymättömät rasvat ja painonhallinta

Rasva on painoyksikköä kohti keholle tehokasta energiaa. Jos rasvaa syödään suuria määriä, osa siitä jää helposti vararavintona elimistöön. Joillain ihmisillä perintötekijöiden ansiosta suurempi rasvan määrä ei suoraan vaikuta painoa nostavasti, jos suuri osa nautitusta rasvasta on tyydyttymätöntä.

Oma tuloksesi:
Jos ruokavaliosi energiasisällöstä yli 30 % on rasvaa, pitämällä kertatyydyttymättömien rasvahappojen osuuden korkealla painonhallintasi on helpompaa kuin jos rasvansaantisi koostuisi pääasiassa tyydyttyneistä rasvoista.

bars

6.4.3 Proteiinit ja painonhallinta

Proteiinien riittävä saanti on ensiarvoisen tärkeää lihasmassan säilyttämisen ja kasvattamisen näkökulmasta. Joillakuilla runsas proteiinien saanti helpottaa painonhallintaa, kun taas joillain toisilla runsasproteiininen ruokavalio tekee painonhallinnasta haastavampaa. Alla on analysoituna omien perintötekijöidesi vaikutus asiaan.

Oma tuloksesi:
Näiden geeniesi puolesta kuulut ryhmään, jonka painonhallinnan kannalta maltillisesti proteiinia sisältävä ruokavalio on suositeltavin - painonhallintasi on helpompaa, jos päivittäisen ravintosi kokonaisenergiasta enintään 15 % tulee proteiineista.

bars

6.4.4 Rasva ja painon palaaminen

Tavoitteellisen painonpudotuksen jälkeen paino saattaa nousta takaisin monesta syystä - joskus ruokavaliomuutokset eivät ole pysyviä tai kenties aiemmin harrastettuun liikuntaan tulee jostain syystä tauko. Tietyillä perinnöllisillä tekijöillä on ruokavalion kanssa yhteys painon paluuseen, ja ruokavalio, jossa suhteessa suurempi osa energiasta saadaan rasvasta, nostaa painoa takaisin joillain ihmisillä paljon nopeammin kuin toisilla.

Oma tuloksesi:
Jos olet pudottanut painoasi ja ruokavaliosi energiasisällöstä enintään 20 % on rasvaa, painosi ei nouse yhtä helposti takaisin kuin jos rasvansaantisi olisi runsaampaa.

bars

6.4.5 Eri ruoat ja painonhallinta

Joidenkin ihmisten suussa rasvaa ja proteiniia sisältävät ruoat maistuvat paremmilta kuin hiilihydraatteja sisältävät, kun taas toisilla on yhtäläinen mieltymys kautta linjan. Geneetinen taipumus suosia näitä ruokia on osaltaan vaikuttamassa kokonaisenergian saantiin, sillä rasvaa suosivat genotyypit syövät keskimäärin enemmän kaloreita päivässä.

Oma tuloksesi:
Ruokahalusi rasvan ja proteiinien suhteen on keskivertoa tasoa.

bars

6.5 Metabolisen oireyhtymän esiintyminen

Metabolinen oireyhtymä on tila, jonka oirekuvaan liittyvät mm. ylipaino erityisesti keskivartalolihavuuden (ns. omenalihavuus) muodossa, kohonnut insuliiniresistenssi, lisääntynyt väsymys, kohonnut verenpaine sekä muita oireita. Se on mm. diabeteksen vaaratekijä. Metabolisen oireyhtymän hoitoon suositellaan muun muassa säännöllistä arkiliikuntaa sekä terveellistä ruokavaliota. Joillain henkilöillä riski metaboliseen oireyhtymään on perinnöllisistä syistä keskivertoa suurempi - tällöin kannattaa kiinnittää erityistä huomiota sen ennaltaehkäisyn mahdollisuuksiin esimerkiksi elintapoja tarkistamalla.

Oma tuloksesi:
Näiden geeniesi perusteella sinulla ei ole kohonnutta perinnöllistä alttiutta metaboliselle oireyhtymälle.

bars

6.5.1 Painonnousulle altistavia tekijöitä

Nämä kaksi tekijää vaikuttavat painonnousuun joko neutraalisti tai taipumusta kasvattavasti.

Oma tuloksesi:
Kuulut näiden perintötekijöidesi puolesta ryhmään, jonka edustajat eivät ole poikkeuksellisen alttiita painonnousulle.

bars

Oma tuloksesi:
Kuulut näiden perintötekijöidesi puolesta ryhmään, jonka edustajat ovat tyypillisesti hieman keskivertoa kookkaampia. Tämän ominaisuuden edustajille liikunta on keskivertoa tärkeämpi tekijä onnistuneessa painonhallinnassa.

bars

6.5.2 Painonnousulta suojaavia tekijöitä

Tämä tekijä on joko neutraali tai vaikuttaa painonnousua hillitsevästi.

Oma tuloksesi:
Kuulut perimäsi puolesta ryhmään, jolle tämä tekijä vaikuttaa lievästi painonnousua hillitsevästi. Tämän ryhmän edustajat ovat tyypillisesti hieman väestön keskiarvoa kevyempiä.

bars

ravinto 7 Ravinto

7.1 Makeanhimo

Useimmilla ihmisillä on jonkinasteinen mieliteko makeaan, ja nälkäisenä ajatus makeasta saattaa olla erityisen mieluisa. Joskus pelkkä asian mainitseminen saattaa johtaa makeanhimoon. On olemassa tiettyjä geenimuunnoksia, jotka kasvattavat joillakin makean tarvetta suuremmaksi kuin keskiverrolla yksilöllä. Niiden ansiosta makeanhimoa esiintyy enemmän, ja sellainen määrä makeaa, josta joku toinen olisi tyytyväinen, saattaa vaikuttaa itselle riittämättömältä. Tällöin kaikenlaista hyvää tulee syötyä useammin ja herkemmin. Perinnöllinen taipumuksesi on:

Oma tuloksesi:
Perintötekijäsi houkuttavat sinua keskivertoa korostuneemmin makean pariin.

bars

7.2 Napostelutaipumus

“Pieni välipala silloin tällöin piristää, ja sanotaanhan, että veren sokeritasosta huolehtiminen on tärkeää esimerkiksi mielialan kannalta.” Toiset ihmiset taasen ovat pitkäänkin syömättä tuntematta erityistä tarvetta naposteluun, ja joskus saattavat huomaamattaankin unohtaa syödä. Napostelun todennäköisyys tosin lisääntyy miltei universaalisti, mikäli jotain maukasta on näköpiirissä. Naposteluherkkyydestä osa on opittua, osa kulloisenkin tilanteen sanelemaa ja osa johtuu perintötekijöistä - ohessa laskelmamme henkilökohtaisesta geeniesi viestistä välipalojen pariin.

Oma tuloksesi:
Perintötekijäsi kehottavat sinua napostelemaan välipaloja silloinkin, kun sille ei ole varsinaista tarvetta.

bars

7.3 Ruokahalu

Ruokahalu syntyy lukuisista osatekijöistä - nälkä on paras kokki, mutta erityisen makoisat ruoat tunnetusti herättävät ruokahalun, vaikka nälkää sinänsä ei sillä hetkellä olisikaan. Nälkäisenä puolestaan on hankalaa ajatella mitään tärkeää, sillä ravinnonhankkimisen sijainti on elimistön sisäisen tärkeysjärjestyslistan yläpäässä. Joidenkin perinnöllisten ominaisuuksien johdosta ruokahalu on erityisen korostunut päätöksentekojärjestelmässä. Tällöin energiantarve ei ole suorassa suhteessa ruokahaluun, vaan ruokahalu on hivenen suurempi kuin mitä elimistö itse asiassa tarvitsisi. Pitkällä aikavälillä nyky-yhteiskunnassamme tämä johtaa painonnousuun, vaikka ruokaa ei olisikaan syöty kuin silloin, kun on ollut nälkä. Olemme tarkastelleet ruokahaluun vaikuttavia omia perinnöllisiä ohjeitasi, ja arviomme on seuraavanlainen:

Oma tuloksesi:
Näiden perintötekijöidesi puolesta näläntunteesi on jonkin verran korostunut, vaikka energiansaannin suhteen sille ei olisikaan sillä hetkellä syytä. Ruokahalusi on suurempi kuin keskiverrolla yksilöllä. Riittävällä liikunnalla pystyt pitämään painosi hallinnassa.

bars

7.4 Syömisen määrän ja mielihyvän yhteys

Pienet makupalat saattavat ilahduttaa suurestikin joitain ihmisiä, kun taas toiset kokevat saman määrän lähinnä häiritsevän riittämättömäksi. Aivojen mielihyväkeskuksen toiminnalla on osuutensa asiaan, ja herkemmin ruoasta mielihyvää saavat ihmiset syövät säännönmukaisesti vähemmän ja täten myös pysyvät helpommin hoikempina. Oma perinnöllinen taipumuksesi on seuraavanlainen:

Oma tuloksesi:
Perimäsi puolesta saat syömisestä keskivertoa vähemmän mielihyvää. Saatat joutua syömään keskivertoväestöä enemmän saman mielihyvämäärän saavuttamiseksi.

bars

7.5 Kitkerän maistamisherkkyys

Jotkut meistä maistavat kitkeryyden helpommin ja herkemmin kuin toiset. Kyseessä on perinnöllinen muunnos kielten makusilmuissa, jotka aktivoituvat pienemmällä kynnyksellä ja saavat herkemmin aikaan makukokemuksen. Riippuen tilanteesta ja tottumuksista, makukokemus voi olla miellyttävä tai epämiellyttävä. Tämä ominaisuus on osittain päällekkäinen niin sanotun supermaistaja -ominaisuuden kanssa, jolle perinnöllistä mekanismia ei ole vielä yksiselitteisesti löydetty. Aiemmin tästä on voinut olla hyötyä, sillä monet kasveissa esiintyvät myrkylliset aineet ovat kitkeriä maultaan. Nykyään sama ominaisuus voi saada henkilön välttelemään esimerkiksi kaaleja, kahvia, humaloituja oluita, sieniä sekä greippiä. Geeniesi osuus tähän on:

Oma tuloksesi:
Kitkeryyden maistamisherkkyytesi on normaali.

bars

7.6 Kasvissuuntautuneisuus

Joillekin ihmisille kasvikset maistuvat syystä tai toisesta huonommin kuin muille. Valikoitujen kasvisten syönti on terveydelle edullista, ja tällöin terveellisen ruokavalion ylläpitäminen saattaa olla haastavampaa, kun suu hangoittelee vastaan. Omat perintötekijäsi asian suhteen:

Oma tuloksesi:
Koet kasvikset maukkaina.

bars

vitamiinit 8 Vitamiinit

8.1 A- ja E-vitamiinien kaltaisten molekyylien (karotenoidit ja tokoferolit) luontaiset tasot elimistössä

Verenkierrossa esiintyvien karotenoidien ja tokoferolien pitoisuus on jossain määrin suhteessa perintötekijöihin. Ne toimivat elimistössä mm. antioksidantteina ja vaikuttavat terveyttä edistävästi. Tiettyjen geenimuunnosten ansiosta veressä voi esiintyä suhteessa enemmän näitä yhdisteitä, ja tätä kautta ne voivat paremmin tehdä oman osuutensa yleisterveyden hyväksi.

Oma tuloksesi:
Nämä geenit vaikuttavat neutraalisti karotenoidi- ja tokoferolitasoosi.

bars

8.2 Retinolin eli A1-vitamiinin luontainen taso elimistössä

Retinoli eli A-vitamiinin yleisin verenkierrossa esiintyvä muoto on tärkeä vitamiini esimerkiksi astman, sydän- ja verenkiertoelimistön sairauksien sekä syövän ehkäisyssä. Perinnöllinen muunnos retinolin kantajaproteiinissa lisää sen pitoisuutta veressä ja sitä kautta vaikuttaa hyvinvointia lisäävästi.

Oma tuloksesi:
Nämä geenit vaikuttavat neutraalisti retinolitasoosi.

bars

8.3 B12-vitamiinin luontainen taso elimistössä

B12 on tärkeä vitamiini muun muassa aivojen ja hermoston toiminnalle. Sen imeytyminen ruoansulatuksessa ja toiminta elimistössä on monimutkainen prosessi. Eräs geenimuunnos nostaa veressä kiertävän B-12-vitamiinin tasoa naisilla.

Oma tuloksesi:
Perintötekijäsi nostavat hiukan B-12-vitamiinitasoasi ja niiden vaikutuksesta luontainen tasosi on näiden geeniesi perusteella hivenen keskivertoa korkeampi.

bars

8.4 D-vitamiinin luontainen taso elimistössä

D-vitamiini on tärkeä elimistön toiminnalle ja ehkäisee mm. osteoporoosia. Joillain ihmisillä perinnöllisen ominaisuuden tähden verenkierrossa esiintyy enemmän kiertävää D-vitamiinia kuin toisilla, ja täten D-vitamiinin edut ovat kyseisillä ihmisillä paremmin hyödynnettävissä. Tällaisen ominaisuuden kantajilla myös nautitut D-vitamiinvalmisteet saattavat nostaa veressä kiertävän D-vitamiinin pitoisuuksia enemmän kuin muilla.

Oma tuloksesi:
Näiden perintötekijöidesi suhteen luontainen D-vitamiinitasosi on näiden geeniesi perusteella hiukan keskivertoa alhaisempi.

bars

mineraalit 9 Hivenaineet ja mineraalit

9.1 Magnesium

Magnesiumin riittävä saanti on tärkeää mm. lihasten normaalin toiminnan kannalta. Magnesium on kriittinen mineraali kehon energiantuotannosta ja DNA:n valmistamisesta vastaavissa entsyymeissä. Hyviä magnesiumin lähteitä ovat esim. pähkinät, kaakao, tattari sekä vihreät kasvikset, mm. pinaatti. Joillain ihmisillä magnesiumia esiintyy veressä enemmän, ja täten tällaisten ominaisuuksien kantajilla esimerkiksi urheilu saattaa olla helpompaa ja lihaskramppeja esiintyä vähemmän.

Oma tuloksesi:
Perinnöllinen magnesiumtasosi on näiden geeniesi perusteella normaali.

bars

9.2 Fosfori

Fosforilla on vaikutusta aineenvaihduntaan ja happo-emästasapainon säätelyyn. Fosfori on merkityksellistä mm. luustolle ja hampaille erityisesti kasvuiässä oleville. Keskimääräinen länsimaalainen fosforin saanti on liiallista. Kroonisesta munuaissairaudesta kärsiville fosfori on suorastaan vaarallista, ja saantisuositukset siten matalampia. Ruoan korkea fosforipitoisuus linkittyy sydän- ja verisuonitauteihin ja nopeuttaa kohonneiden lisäkilpirauhashormonin pitoisuuden kautta luun hajoamista. Liian korkea fosforipitoisuus verisuonissa voi kalkkeuttaa niitä ja johtaa ennenaikaiseen kuolemaan. Fosforipitoisia ravintoaineita ovat mm. lukuisat maitotuotteet (erit. sulatejuustot) sekä täysjyvävilja, pähkinät, kaakao, kolajuomat, lihajalosteet.

Oma tuloksesi:
Perinnöllinen fosforitasosi on näiden geeniesi perusteella normaali.

bars

9.3 Sinkki

Sinkin saanti on länsimaisessa ruokavaliossa yleisesti riittävällä tasolla, ja sen puutoksesta kärsivätkin yleensä lähinnä vegaanit ja laihduttajat. Sinkkiä on runsaasti äyriäisissä, lihassa, eritoten maksassa, monissa maitotuotteissa ja juustoissa. Kasvikunnan tuotteista täysjyvävilja, monet pähkinät (erit. parapähkinät), vehnänalkiot- ja leseet, monet siemenet kuten auringonkukan- ja kurpitsansiemenet ovat sinkkirikkaita. Elimistössä sinkkiä tarvitaan mm. lukuisten kehitykseen ja hedelmällisyyteen liittyvien entsyymien rakennusosaksi sekä DNA-synteesiin. Eritoten lapsilla sinkin puute saattaa aiheuttaa kasvun hidastumista ja altistaa jopa aivojen kehityshäiriöille.

Oma tuloksesi:
Perinnöllinen sinkkitasosi on näiden geeniesi perusteella normaali.

bars

9.4 Kalsium

Kalsium on yleisin elimistön kivennäisaine ja sitä tarvitaan lukuisiin kehon prosesseihin, mm. normaaliin sydämen toimintaan, lihassupistuksiin ja hermoimpulssien kulkuun, minkä lisäksi kalsium on oleellinen solukalvojen läpäisevyyden ja nestetasapainon säätelyssä. Kalsiumin lähteitä ovat lehti- ja parsakaali, pähkinät ja mantelit, soija, ruotoineen syötävät kalat sekä maitotuotteet. Kalsiumin imeytymiseen suolistosta vaikuttavat olennaisesti mm. D- ja K-vitamiini, ikä, hormonitaso sekä ravitsemus, kuten kahvinjuonti, kuidun määrä (täysjyväviljan fytaatit häiritsevät imeytymistä) sekä valkuaisaineiden saanti. Saantisuositus vaihtelee huomattavasti esim. iän myötä. Kalsiuminpuutos altistaa luuston heikkenemiselle, mutta vastoin yleistä harhaluuloa, maitotuotteiden runsas kulutus yksinään ei välttämättä olekaan tehokas keino suojautua osteoporoosia vastaan. Liiallinen kalsiumin saanti on verrattain yleistä, aiheuttaen mm. muiden mineraalien imeytymishäiriöitä, pehmytkudosten kalkkeutumista, ummetusta ja entsyymitoiminnan häiriöitä.

Oma tuloksesi:
Perinnöllinen kalsiumtasosi on näiden geeniesi perusteella keskivertoa korkeampi.

bars

9.5 Kupari

Kupari on harvinainen, mutta tarpeellinen kehon mineraali, jota tarvitaan mm. rauta-aineenvaihduntaan, hermoston normaaliin toimintaan, puna- ja valkosolujen kypsymiseen ja hapetus-pelkistysreaktioihin. Kupari osallistuu solun energiantuotantoon eli ATP:n valmistukseen, minkä ohella sillä on merkitystä solun tukirangalle ja vastustuskyvyn kehitykselle. Elimistössä sitä on varastoituneena erityisesti luihin ja lihaksiin. Kuparinpuutos on harvinaista terveillä aikuisilla, mutta sitä aiheuttavat mm. liiallinen kalsiumin, fosforin tai sinkin saanti, munuaisvaurio, letkuruokinta sekä suolen ohitusleikkaukset. Hyviä kuparinlähteitä ovat sisäelimet, liha, kala, äyriäiset, pähkinät, siemenet ja leseet, viljatuotteet sekä kaakao. Puutteellinen kuparinsaanti voi johtaa esimerkiksi anemiaan sekä tukikudoksen muutoksiin ja hermokudoksen tuhoutumiseen.

Oma tuloksesi:
Perinnöllinen kuparitasosi on näiden geeniesi perusteella normaali.

bars

urheilu 10 Urheilu ja suorituskyky

10.1 Angiotensiinientsyymisi (ACE) genotyyppi

Angiotensiinientsyymi on verenpainetta ja verisuonten supistumista säätelevä entsyymi. Monissa tutkimuksissa on havaittu sen eri versioiden eli alleelien vaikutus suorituskykyyn. Vaihtoehtoina ovat joko insertio (I), jossa geenissä on ylimääräinen toistojakso, tai deleetio (D), jossa kyseinen jakso puuttuu. Insertio (I) vähentää entsyymin määrää veressä. Tällöin I-alleelin kantajilla on hitaampi vaste urheilun tuottamaan verenpaineen nousuun, sydämen sykkeeseen sekä heillä on suurempi maksimihapenottokapasiteetti. I-alleeli on täten kestävyyttä lisäävä alleeli. D-alleelin kantajilla on puolestaan suurempi määrä entsyymiä veressä. Täten D-alleelin kantajilla urheillessa verenpaine ja sydämen syke nousevat nopeammin sekä hapenottokyvyn maksimi saavutetaan aiemmin. D-alleelin kantajilla myös sydämen vasen kammio kasvaa nopeammin liikuntaharjoittelun johdosta. I-alleelia tavataan keskimääräistä todennäköisemmin kestävyysurheilijoilla ja D-alleelia puolestaan räjähtävää tehoa vaativien lajien harrastajilla. Oma genotyyppisi on seuraava:

Oma tuloksesi:
Angiotensiinientsyymisi genotyyppi on ID. Suorituskykysi on täten yhdistelmä kestävyys- ja voimaurheilua.

bars

10.2 Kestävyysurheilu

Kestävyysurheilun luontainen ominaisuustaso koostuu lukuisista erilaisista perintötekijöistä. Analyysissämme on laskettu oman genomisi pohjalta yleinen taipumuksesi tällä saralla.

Oma tuloksesi:
Perinnölliset taipumuksesi kestävyysurheiluun ovat normaalia tasoa.

bars

10.3 Voimaurheilu

Kuten kestävyysurheilussa, myös voimaurheilussa luontainen ominaisuustaso koostuu lukuisista erilaisista perintötekijöistä. Analyysissämme on laskettu oman genomisi perinnöllisten muunnoksien pohjalta voimaurheiluun liittyvä geneettinen taipumuksesi.

Oma tuloksesi:
Voimaurheilutaipumuksesi on keskivertoa tasoa.

bars

10.4 CRP-tulehdustekijät

Jokaisella ihmisellä on elimistössään C-reaktiivista proteiinia, jonka määrä verenkierrossa kohoaa, kun elimistössä on tulehdus. CRP-arvoa käytetään usein mittaamaan tulehduksen vakavuutta ja sen määrä kohoaa hitaasti elimistön ikääntyessä. Joillakin ihmisillä on luontaisesti korkeampi CRP-taso veressään kuin muilla. Tällöin heidän elimistönsä on koko ajan pienen rasituksen alaisena ja heidän elimistönsä saattaa myös reagoida taudinaiheuttajiin muita herkemmin. Tällöin kunnosta huolehtiminen on heille tärkeämpää ja terveyden ylläpitäminen tuottaa suuremman hyödyn kuin keskiverrolla ihmisellä.

Oma tuloksesi:
Perinnöllinen CRP-tasosi on jonkin verran keskivertoa alempi.

bars

10.5 Akillesjänteen tulehdusriski

Akillesjänne yhdistää kantaluun pohjelihakseen ja on rasituksenalaisena useimmissa urheilulajeissa. Siinä esiintyvät tulehdukset tai mikrovauriot voivat huonossa tapauksessa estää harjoittelun ja näin aiheuttaa suurta haittaa harjoitusaikataululle. Joillain ihmisillä on kohonnut perinnöllinen riski akillesjänteen tulehdukselle. Tällöin harjoitusohjelman suunnittelussa on syytä ottaa asia huomioon.

Oma tuloksesi:
Näiden geeniesi suhteen perinnöllinen riskisi akillesjänteen tulehdukselle on kohonnut.

bars

10.6 Eturistisiteen vaurioitumisriski

Eturistiside on polvessa esiintyvä sidekudosside. Eturistisiteen vaurioituminen on urheiluharrastuksissa yleistä. Sen paraneminen saattaa kestää jopa puoli vuotta, joten harjoitteluaikataulu menee tällöin uusiksi. Perinnölliset ominaisuudet voivat suojata eturistisiteen repeämältä, sillä tietyillä perintötekijöillä on suojaava vaikutus. Tämä ei kuitenkaan tarkoita, etteikö eturistiside voisi lainkaan vaurioitua - todennäköisyys siihen on vain pienempi.

Oma tuloksesi:
Näiden geeniesi suhteen perinnöllinen riskisi eturistisidevammalle on normaali.

bars

10.7 Palautuminen

Urheillessa elimistö joutuu rasitustilaan, ja mitä pidempään tai mitä intensiivisempää rasitus on, sitä enemmän elimistön on palauduttava suorituksesta rasituksen jälkeen. Palautumiseen vaikuttavat muun muassa elimistön polttoainetta, ATP:tä, kuljettavien järjestelmien yhteistoiminta. Joillain ihmisillä elimistön uudelleentankkausjärjestelmä on hitaampi ja rasituksesta palautuminen kestää kauemmin kuin keskiverrolla yksilöllä. Palautumisen aikana saattaa esiintyä tavanomaista enemmän kipuja. Joskus kipuja alkaa esiintyä myös rasituksen aikana, mikäli sen intensiteetti ylittää elimistön kantokyvyn.

Oma tuloksesi:
Tämä geneettinen palautumisominaisuutesi on keskivertoa tasoa.

bars

10.8 Lihasvauriot harjoittelun aikana

Harjoitellessa lihaksiin syntyy mikrovaurioita, jotka vähentävät lihaksen toimintakykyä ja aiheuttavat harjoittelun jälkeen kipeytymistä. Joillain ihmisillä lihakset ovat vastustuskykyisempiä rasitukselle esimerkiksi urheiluharrastuksen ansiosta, jolloin vaurioita syntyy vähemmän ja lihakset eivät kipeydy yhtä helposti. Perinnöllisillä ominaisuuksilla on oma osuutensa asiaan - joidenkin ominaisuuksien kantajilla lihakset vaurioituvat urheillessa enemmän.

Oma tuloksesi:
Lihastesi kestokyky on näiden geeniesi suhteen normaalia matalampi, ja lihaksesi vaurioituvat harjoitellessa keskivertoa enemmän.

bars

10.9 Kipukynnys

Kivuntunteen ärsyttävyys riippuu monesta seikasta ja vaihtelee tilanteen mukaan - esimerkiksi väsyneenä kipu saatetaan kokea voimakkaampana kuin virkeänä ollessa. Joillain ihmisillä parantuneen vaurion jälkeen saattaa esiintyä selittämätöntä kipua vaurioituneella alueella, vaikka vamma olisikin jo parantunut. Kipua voi myös esiintyä ilman mitään suoraa yksittäistä syytä. Tutkimuksissa on havaittu joidenkin geenimuunnosten vaikuttavan kivuntunnetta vähentävästi ja joidenkin toisten puolestaan kivuntunnetta lisäävästi, jolloin sama asia tuntuu erilaiselta eri ihmisillä.

Oma tuloksesi:
Näiden geeniesi suhteen perinnöllinen kipukynnyksesi on keskivertoa tasoa.

bars

10.10 Veressä kiertävien verisuonten kasvutekijöiden määrä

Verenkierrossa kiertää runsaasti erilaisia kasvutekijöitä, joiden tehtävänä on ohjata elimistön kasvuprosesseja suuntaan tai toiseen. Verisuonten kasvutekijöiden tehtävänä on ohjata uusien verisuonten kasvamista esim. haavojen parantuessa, luutumisessa sekä lihasten kasvattamisessa ja myös kuukautiskierron aikana. Suuri kasvutekijöiden määrä voi johtaa nopeampaan haavojen parantumiseen ja myös lihaskudoksen kasvutahtiin, jolloin harjoittelu voi olla tuloksekkaampaa nopeammin.

Oma tuloksesi:
Perinnöllinen verisuonten kasvunopeutesi on keskivertoa tasoa.

bars

10.11 Lihasten perinnöllinen voimataso

Lihasten voimakkuus riippuu lukuisista tekijöistä, kuten iästä, aiemmasta harjoittelusta, vireystilasta ja niin edelleen. Joillakin ihmisillä perinnölliset ominaisuudet nostavat lihasten yleistä voimatasoa niin, että harjoittelulla tulokset näkyvät nopeammin ja lihakset ovat keskivertoon tasoon suhteutettuna voimakkaampia, vaikka urheilua ei olisikaan tullut sen suuremmin harrastettua.

Oma tuloksesi:
Lihastesi perinnöllinen voimataso on normaali.

bars

10.12 Hapenottokyky

Hapenottokykyä määrittävät useat geneettiset seikat, ja hivenen alle 50 % hapenottokyvyn harjoittamisen vasteesta on perinnöllisistä seikoista riippuvaista. Analyysissämme olemme tarkistaneet näistä seikoista yksittäisen suurinta vaikutusta kantavan, joka lisää maksimaalisen hapenottokyvyn harjoitteluvastinetta noin 6 %.

Oma tuloksesi:
Tämän ominaisuuden suhteen maksimaalinen hapenottokykysi on normaalia tasoa.

bars

terveys 11 Terveys ja oma keho

11.1 Sokeriaineenvaihdunta

11.1.1 Paastoverensokerin taso

Nämä geenimuunnokset vaikuttavat luontaiseen verensokeritasoon, kun ravinnonsaannista on kulunut pidempään eli elimistö on mennyt paastotilaan. Joillain ihmisillä paastottaessa verensokerin pitoisuus on suurempi kuin toisilla, ja tämä saattaa vaikuttaa mm. nälän kokemiseen paaston edetessä.

Oma tuloksesi:
Paastonaikainen perinnöllinen verensokeritasosi on hivenen keskivertoa tasoa korkeampi.

bars

11.1.2 Paaston yhteys veren kiertävään triglyseridimäärään

Paastottaessa elimistössä tapahtuu monia muutoksia – muun muassa rasvaa vapautuu verenkiertoon energianlähteenä käytettäväksi. Joillain ihmisillä verenkiertoon vapautuvan rasvan määrä on suurempi ja triglyseridejä painotetaan HDL-kolesterolitason kustannuksella. Tämä saattaa esim. ylläpitää paaston aikaista toimintakykyä paremmin.

Oma tuloksesi:
Näiden perintötekijöidesi puolesta paastonajan triglyseriditasosi ovat normaalia korkeammat.

bars

11.1.3 Verensokerin nousunopeus ruoan yhteydessä

Joillain ihmisillä verensokeri nousee jyrkemmin ruoan jälkeen kuin toisilla. Tällöin kylläisyyden tunne syntyy nopeammin, mutta nopean verensokerin nousun jälkeinen insuliininerityshuippu saattaa johtaa myös vastaavasti nopeaan verensokerin laskuun, jolloin ruoanjälkeinen väsymys tai uupumus voidaan kokea suurempana. Erityisesti puhdasta sokeria nautittaessa nousu ja lasku saattavat tuntua hyvin voimakkaina. Tämä geenimuunnos on riskitekijä tyypin 2 diabeteksen synnyssä.

Oma tuloksesi:
Perintötekijöidesi puolesta verensokerisi reagoi normaalisti ravintoon.

bars

11.1.4 Raskausajan diabetes

Raskaudenaikainen diabetes voi syntyä monen tekijän yhteisvaikutuksesta. Monia riskitekijöitä on tunnistettu, esim. suvussa esiintynyt sokeritauti tai äidin tupakointi altistavat raskaudenaikaiselle diabetekselle. Yhtenä riskitekijänä ovat geneettiset seikat, mutta noin 50 % raskaudenaikaisen diabeteksen sairastaneista eivät ole kuuluneet mihinkään ennalta määrättyyn riskiryhmään. Täten geenienkin vaikutus on suuntaa-antava, ja omilla elintapavalinnoilla riskiä voi alentaa huomattavasti. Mikäli olet fyysisesti mies, kyseinen ominaisuus ei välttämättä ole relevantti kohdallasi, vaan pikemminkin antaa tietoa sukulaistesi taipumuksesta.

Oma tuloksesi:
Raskaudenajan diabeteksen riskisi on koholla.

bars

11.2 Verenpaine

11.2.1 Verenpaineen reagointi suolan saantiin

Verenpaineen tasot johtuvat lukuisista tekijöistä, joista tärkeimpinä ulkoisina seikkoina vaikuttamassa ovat tupakointi tai tupakoimattomuus, paino, suolan saanti ja ruokavalio. Perimällä on oma osuutensa erityisesti natriumin ja kaliumin saannin ja kohonneen verenpaineen yhteydessä. Vaikka kaikkien kannattaakin tarkkailla natriumin saantiaan, tiettyjä perintötekijöitä kantavien on suositeltavaa olla tässä astetta tarkempia.

Oma tuloksesi:
Näiden perintötekijöidesi suhteen suola ei erityisesti nosta verenpainettasi.

bars

11.2.2 Unenpuutteen aiheuttama verenpainetaudin riski

Joillain ihmisillä vähäinen unensaanti voi olla huomattava riskitekijä verenpainetaudin synnyssä. Esimerkiksi kolmivuorotyö voi altistaa tämän genotyypin edustajia keskiarvoa enemmän verenpainetaudin synnylle - mitä enemmän ja säännöllisemmin unen puutetta esiintyy, sitä korkeampi riski on. Riittävä unensaanti on terveyden kannalta erittäin tärkeää, ja siitä kannattaa huolehtia, vaikka tätä nimenomaista riskiä ei olisikaan.

Oma tuloksesi:
Näiden geeniesi perusteella unenpuute nostaa verenpainetaudin riskiäsi keskivertoa enemmän.

bars

11.2.3 Alkoholin ja verenpaineen nousun yhteys

Alkoholin nauttiminen voi nostaa verenpainetta, ja joillain ihmisillä vaikutus voi olla suhteessa runsaasti suurempi kuin toisilla. Osa vaikutuksen suuruudesta määrittyy geenimuunnoksien perusteella, ja tiettyjen ominaisuuksien kantajille voi olla suositeltavaa suhtautua normaalia varovaisemmin alkoholinkäyttöön, mikäli suvussa esiintyy verenpainetautia tai kohonneen verenpaineen riskiä.

Oma tuloksesi:
Näiden geeniesi puolesta alkoholin nauttiminen nostaa verenpainettasi tavanomaisella tavalla.

bars

11.3 Erilaisten tautien vastustuskyky

Eri taudinaiheuttajilla on lukemattomia erilaisia, niille itselleen tyypillisiä keinoja tunkeutua elimistöön ja aiheuttaa haittaa. Menneinä vuosisatoina tartuntataudit olivat suurena taakkana ihmiskunnalle ja niiden aiheuttamat vaikutukset näkyvät vielä nykyäänkin, esimerkiksi perinnöllisten vastustuskykyominaisuuksien esiintymisenä tietyillä alueilla maailmassa. Eräs menneiden vuosisatojen tuottama ominaisuus on sattuman kautta mahdollisesti hyödyllinen myös nykypäivänä. Ruttoa tai isorokkoa vastaan suojaava geenimuunnos antaa vastustuskykyä myös HI-virusta vastaan. Tällöin immuunijärjestelmän solun pinnalla normaalisti oleva CCR5-molekyyli on normaalia lyhyempi, ja HI-virus ei voi käyttää sitä yrittäessään tunkeutua soluun. Täten virus ei pääse lisääntymään ja on otollinen kohde puolustusjärjestelmän siivoustoiminnalle. Jos olet perinyt ominaisuuden toiselta vanhemmistasi, sairaus voi tarttua, mutta etenee hitaammin. Jos taas olet perinyt ominaisuuden molemmilta vanhemmiltasi, olet onnekkaan sattuman kautta vastustuskykyinen HI-viruksen tyyppiä 1 vastaan. Koska HI-virusta on myös muita tyyppejä (tyyppi 1 kattaa noin 85-90 % viruspopulaatiosta), emme kuitenkaan suosittele riskikäyttäytymisen lisäämistä tätä testataksesi.

Oma tuloksesi:
Olet genotyypiltäsi heterotsygootti I/D. Sinulla on osittain kohonnut vastustuskyky M-trooppiselle HI-1-virukselle. Emme silti suosittele riskikäyttäytymisen lisäämistä tätä testataksesi.

bars

allergiat 12 Allergiat

12.1 Allergiariskin perinnöllinen osuus

Allergia on kattokäsite, joka yksinkertaisimmillaan tarkoittaa elimistön suhteettoman voimakasta immuunireaktiota jollekin vaarattomalle aineelle. Allerginen reaktio etenee erään puolustusjärjestelmän osasen, immunoglobuliini E:n välityksellä. Sen roolina normaalisti on puolustusjärjestelmän aktivointi erityisesti erilaisia loisia vastaan. Joillain ihmisillä sen toiminta käynnistyy tavanomaista herkemmin ja myös kohdistuu vaarattomampiin kohteisiin. Identtisillä kaksosilla toisen ollessa allerginen, esiintyy allergia toisellakin kaksosista 70 % todennäköisyydellä, joten kyseessä on voimakkaasti perinnöllinen ominaisuus. Allergian syntytodennäköisyys riippuu monesta perinnöllisestä muunnoksesta, joista olemme laskeneet omia henkilökohtaisia allergisoitumisriskejäsi.

12.2 Alttius maapähkinäallergialle

Jonkinasteista maapähkinäallergiaa esiintyy länsimaissa noin 1-2 prosentilla väestöstä. Sen aiheuttamat oireet, kuten hengitysteiden turpoaminen, ovat vaarallisemmasta päästä allergioiden oireita, ja maapähkinäallergia harvemmin häviää iän myötä. Analyysimme kertoo perinnöllisestä taipumuksestasi seuraavaa:

Oma tuloksesi:
Nämä geenisi eivät vaikuta maapähkinäallergian todennäköisyyttä lisäävästi.

bars

12.3 Alttius heinänuhalle

Heinänuha eli kasvien siitepölyn aiheuttama allerginen nuha on rasitteena pääasiassa keväisin ja kesäisin, kun kukinta-aika on vilkkaimmillaan, mutta esimerkiksi pujo aiheuttaa oireita vielä myös loppukesästä. Oireina voi esiintyä myös silmien kutinaa. Suomalaisista noin 15-20 prosenttia kärsii jonkinasteisesta heinänuhasta - perinnöllinen taipumuksesi heinänuhaan on analyysimme mukaan seuraavanlainen:

Oma tuloksesi:
Näiden geeniesi suhteen sinulla on kohonnut perinnöllinen alttius heinänuhalle.

bars

ominaisuudet 13 Satunnaiset mielenkiintoiset ominaisuudet

13.1 Herkkyys eri tuoksumolekyyleille eli pieni makumieltymysopas

Ihmisten taipumus pitää erilaisia tuoksuja miellyttävinä on osaksi ympäristön ja osaksi perintötekijöiden ansiota. Ruoan mausta puhuttaessa useimmiten puhutaan itse asiassa tuoksuista, sillä suu maistaa vain viisi perusmakua. Monien tuoksumolekyylien joukosta on löytynyt muutamia, joiden kokemiselle on geneettinen perusta ja jotka täten voivat vaikuttaa muun muassa ravintomieltymyksiisi – ohessa on pieni avain henkilökohtaiseen tuoksumaailmaasi!

13.2 Kukkien tuoksu

Tämä ominaisuus kertoo nenäsi herkkyyden beta-jononi -nimiselle molekyylille. Oudosta nimestään huolimatta se on tärkeänä osana joidenkin kukkien tuoksussa, ja jotkut ihmiset saattavat kokea sen myös hiukan puumaisena. Tätä tuoksumolekyyliä esiintyy esimerkiksi vadelmissa, mansikoissa, mehiläisvahassa, orvokeissa sekä monissa hedelmissä. Jos pidät kukkien tuoksusta, tämä ominaisuutesi saattaa olla osaltaan siitä vastuussa.

Oma tuloksesi:
Tämä geenisi herkistää hajuaistiasi huomaamaan beta-jononin tuoksun keskivertoa tarkemmin.

bars

13.3 Maltaiden ja viljan tuoksu

Isobutyyrialdehydi-niminen molekyyli on tuoksun osasena esimerkiksi maltaissa. Yleensä sen tuoksu koetaan viljan tai oljen kaltaisena, ja joillekin se saattaa tuoda mieleen esimerkiksi heinänteon. Jotkut ihmiset ovat perinnöllisesti herkempiä tälle tuoksulle, ja täten saattavat mielellään viihtyä esimerkiksi erilaisten leipien tai oluiden parissa.

Oma tuloksesi:
Tämä geenisi herkistää nenääsi isobutyyrialdehydin tuoksulle.

bars

13.4 Hien aistiminen

Androstenoni on feromoni, jota esiintyy muun muassa hiessä tai kastroimattoman uroskarjun lihassa. Joillekin ihmisille sen tuoksu on huomattavan epämiellyttävä ja toisille taasen ei - genotyypistä riippuen se saatetaan kokea esimerkiksi vanhan virtsan tai vaihtoehtoisesti, mielenkiintoista kyllä, vaniljan tuoksuisena. Jotkut puolestaan eivät haista tätä tuoksua lainkaan.

Oma tuloksesi:
Tämä geenisi herkistää nenäsi huomaamaan androstenonin tuoksun keskivertoa tarkemmin ja se saattaa tuoksua nenässäsi esimerkiksi vanhalle virtsalle tai hielle.

bars

13.5 Parsan tuoksun aistiminen

Parsaa sisältävän aterian jälkeen jotkut meistä havaitsevat erittäin helposti muutaman tunnin jälkeen syöneensä parsaa. Toiset taas eivät kiinnitä asiaan mitään huomiota. Kyky tunnistaa parsan aineenvaihduntatuotteiden tuoksu on niin ikään perinnöllinen - henkilöille, jolla tämä ominaisuus on, kyseiset molekyylit tuntuvat nenässä rikinkatkua etäisesti muistuttavina.

Oma tuloksesi:
Tämä geenisi herkistää nenääsi parsan aineenvaihduntatuotteiden tuoksulle, jotka yleensä koetaan rikinkaltaisina.

bars

13.6 Muita ominaisuuksia

13.7 Kirkkaan valon aiheuttama aivastusreaktio

Tullessaan pimeästä kirkkaaseen valoon, esimerkiksi autossa pitkän tunnelin jälkeen tai aurinkoisena aamulla töihin lähtiessä, jotkut meistä saattavat aivastaa todennäköisemmin kuin toiset. Tällekin on olemassa perinnöllinen pohja, mutta tämän ominaisuuden varsinaista evolutiivistä etua ei olla vielä onnistuttu päättelemään.

Oma tuloksesi:
Tämä geenisi aiheuttaa suuresti kutkutusta nenässäsi siirryttäessä pimeästä kirkkaaseen valoon, ja aivastuksen todennäköisyys on tällöin kohonnut.

bars

13.8 Henkilökohtainen ominaistuoksu

Useimmilla ihmisillä on tavanomainen ominaistuoksu, mutta joillakin yksilöillä ominaistuoksu on vaimeampi kuin toisilla. Tällöin esimerkiksi deodoranttia ei välttämättä tarvitse käyttää päivittäin - tietysti esimerkiksi ihon omalla mikrobikannalla, yleisellä terveydentasolla ja monilla muilla seikoilla on myös osuutta asiaan. Korvavaikun kosteustaso on niin ikään tämän geenin säätelemää, ja eri ihmisillä sen koostumus vaihteleekin kosteasta kuivaan.

Oma tuloksesi:
Tämän geenisi johdosta korvavaikkusi on kosteaa. Lisäksi ominaistuoksusi on asteen keskivertoa vaimeampi.

bars

persoonallisuus 14 Persoonallisuus

14.1 Stressinsieto ja toimintakyky

Joidenkin ihmisten toimintakyky on parempi stressittömässä ympäristössä, kun taas toiset ovat parhaimmillaan pienen paineen motivoimina. Aivojen välittäjäaineita käsittelevien entsyymien toiminnalla on oma osuutensa asiaan, ja joillain ihmisillä niiden erilaiset toimintatasot saattavat ilmetä hyvinkin suurina kontrasteina eri tilanteiden suorituskykyä tarkkailtaessa.

Oma tuloksesi:
Dopamiinitasosi ovat näiden perintötekijöidesi johdosta hivenen korkeammalla kuin keskiverrolla ihmisellä. Stressi voi täten vaikuttaa suorituskykyysi haitallisesti. Jos pystyt toimimaan stressittömässä ympäristössä, henkinen suorituskykysi voi puolestaan olla parempi kuin keskiverrolla ihmisellä.

bars

14.2 Addiktioherkkyys

Erilaisten riippuvuuksien synty on useimmiten pitkäaikainen ja monivaiheinen prosessi. Joillain ihmisillä perinnölliset välittäjäaineiden toiminnan muutokset altistavat hyvinkin nopealle addiktion synnylle ja tekevät riippuvuudesta eroon pääsemisestä keskivertoa hankalampaa, kun taas toiset pystyvät lopettamaan esimerkiksi tupakoinnin hämmentävänkin helposti.

Oma tuloksesi:
Näiden geenien perusteella opit keskivertoa huonommin virheistäsi, mutta vastapainona pakko-oireisen häiriön riskisi on madaltunut. Riippuvuuusherkkyytesi on suurehko ja genotyyppisi edustajat jäävät helposti kiinni asioihin. Jos tupakoit ja haluat lopettaa, bupropionista ei ole kohdallasi apua.

bars

14.3 Introverttiys

Eri persoonallisuuskokonaisuuksia on yhtä monta kuin eri yksilöitä, ja toisissa tilanteissa reagoimme samoihin asioihin eri tavalla kuin toisissa. Tietyille persoonallisuustaipumuksille on löydetty suuntaa-antavaa geneettistä pohjaa, ja joidenkin ominaisuuksien on havaittu esiintyvän todennäköisemmin tiettyyn suuntaan kallellaan olevilla henkilöillä. Introverttiys eli itsenäinen toiminnallisuus on ollut ekstroverttiyden eli sosiaalisen toiminnallisuuden kanssa tutkittavana monissa eri yhteyksissä. Jotkut meistä viihtyvät itsekseen huomattavasti paremmin kuin toiset, ja saavat ladattuja akkujaan paremmin ollessaan itsekseen. Toiset puolestaan energisoituvat sosiaalisissa tilanteissa ja ovat mielummin seurassa. Omat geenisi antavat asiaan seuraavanlaisen taipumuksen:

Oma tuloksesi:
Tämä perinnöllinen ominaisuutesi sosiaalisuuden suhteen on keskivertoa tasoa.

bars

lääkevasteet 15 Lääkevasteet

Perinnölliset muunnokset eri entsyymien rakenteessa ja esiintymistasoissa vaikuttavat suuresti erilaisten lääkkeiden metaboliaan elimistössä. Erilaisten ominaisuuksien johdosta jotkin lääkkeet voivat vaikuttaa hitaammin, nopeammin tai jopa aiheuttaa vaikeita sivuvaikutuksia. Tietämällä perinnölliset taipumuksesi voit yhdessä lääkärisi tai apteekin henkilökunnan kanssa varmistaa, että lääkintään valitaan vain Sinulle soveltuvia tuotteita. Ohessa on muutama esimerkki erilaisten entsyymien vaikutuksista. Erilaisia entsyymivariaatioita on satoja, joten emme ole eritelleet esimerkinomaisesti tässä niitä kaikkia. Haluamme kuitenkin antaa Sinulle kattavan katsauksen näistä, joten olemme laittaneet variaatiot listaan, ja voit käyttää tätä taulukkoa referenssinä lääkärisi ja farmaseuttisi kanssa, mikäli lääkeaineenvaihdunnasta nousee esiin kysymyksiä.

15.1 Entsyymi CYP1A2, rs2069514, rs28399424, rs56276455, rs762551

Tämä entsyymi metaboloi muun muassa kofeiinia, varfariinia, tamoksifeeniä sekä useita masennuslääkkeitä (amitriptyliini, klomipramiini, imipramiini jne.). Tarkempaa tietoa lääkeaineinteraktioista saat tarvittaessa lääkäriltäsi tai apteekin henkilökunnalta.

Oma tuloksesi:
Näiden muunnelmiesi perusteella CYP1A2-entsyymisi toiminta on hitaampaa kuin väestöllä keskimäärin. Täten sen välityksellä toimivat lääkkeet toimivat eri nopeudella kuin normaalisti, varsinainen vaikutus ollen aina lääkkeestä riippuvainen.

bars

15.2 Geeni TBX21, rs4794067

TBX21 on geeni, joka osallistuu immuunijärjestelmän tärkeän osasen, auttaja-T-solujen toimintaan. Joillain yksilöillä tämän geenin harvinainen muunnos voi herkistää aspiriinille ja joissain tapauksissa myös muille tulehduskipulääkkeille. Tällöin näitä lääkkeitä käytettäessä normaalisti esiintyvät astman oireet saattavat yllättäen pahentua. Kyseinen ilmiö tunnetaan myös Samterin triadin tai asetyylisalisyylihapon pahentaman astman nimellä.

Oma tuloksesi:
Sinulla on CT-genotyyppi geenissä TBX21, rs4794067. Tämä geenimuunnos voi herkistää sinua aspiriinille, jolloin sitä käyttäessäsi aspiriinin aiheuttaman astman eli Samterin triadin riskisi on kohonnut.

bars

15.3 Entsyymi protrombiini F2, rs1799963, G20210A

Veren hyytyminen on monimutkainen aineenvaihduntaketju, jossa on mukana yli kymmenen erilaista hyytymistekijää. Tässä olemme tarkastaneet tekijän numero kaksi, joka esiintyy noin 2-4 prosentilla eurooppalaisista. Tämän tekijän muunnos lisää veren hyytymistaipumusta, kohottaen veritulppariskiä ja esimerkiksi ehkäisypillereiden käytön yhteydessä saattaa altistaa veritulppien synnylle. Tietämällä perinnöllisen taipumuksesi voit vaikuttaa mahdolliseen lääkitykseesi keskustelemalla asiasta lääkärisi kanssa.

Oma tuloksesi:
Genotyyppisi on AA. Sinulla on kaksi G20210A-mutaatiota protrombiinigeenissä F2. A-alleelin kantajilla on havaittu kasvanut veritulppariski erityisesti yhdistelmäehkäisypilleriä käytettäessä.

bars

15.4 Entsyymi Factor V Leiden F5, rs6025, Arg506Glu / R506Q

Veren hyytyminen on monimutkainen aineenvaihduntaketju, jossa on mukana yli kymmenen erilaista hyytymistekijää. Näistä olemme tarkastaneet tekijän numero viisi eli niinsanotun Leidenin tekijän perinnöllisen muunnoksesi. Useimmilla henkilöillä tekijä viisi on normaali. Eurooppalaisista noin 2-4 % kantaa kuitenkin perinnöllistä muunnosta, joka kohottaa veritulppariskiä ja esimerkiksi ehkäisypillereiden käytön yhteydessä saattaa altistaa veritulppien synnylle. Tietämällä perinnöllisen taipumuksesi voit vaikuttaa mahdolliseen lääkitykseesi keskustelemalla asiasta lääkärisi kanssa.

Oma tuloksesi:
Genotyyppisi on AG. A-alleelin kantajilla on havaittu kasvanut veritulppariski erityisesti yhdistelmäehkäisypilleriä käytettäessä.

bars

15.5 Geeni SLCO1B1, rs4149056, 521T>C

Tämä entsyymi on osallisena statiinien eli tavanomaisimpien kolesterolilääkkeiden metaboliassa. Joillain yksilöillä statiinit voivat aiheuttaa suuria sivuvaikutuksia, mikäli perinnöllinen alttius niille on olemassa.

Oma tuloksesi:
Genotyyppisi on CC. Metaboliasi on tämän ominaisuuden suhteen huomattavasti muuttunut. Olet suuressa sivuvaikutusten riskissä statiinilääkitystä käytettäessä.

bars

15.6 Geeni SLCO1B1, rs4363657

Tämä entsyymi on osallisena statiinien eli tavanomaisimpien kolesterolilääkkeiden metaboliassa. Joillain yksilöillä statiinit voivat aiheuttaa suuria sivuvaikutuksia, mikäli perinnöllinen alttius niille on olemassa.

Oma tuloksesi:
Genotyyppisi on CT. Metaboliasi on tämän ominaisuuden suhteen muuttunut. Olet sivuvaikutusten riskissä statiinilääkitystä käytettäessä.

bars